View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_204 (Length: 260)
Name: NF1345_high_204
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_204 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 108 - 253
Target Start/End: Original strand, 31755384 - 31755529
Alignment:
| Q |
108 |
aaacatatatattgaataataatgatagaattgaattcataaaatatagacctgttttttccaattcgtaagagatgtaatgatggaaagaaaaattgtt |
207 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31755384 |
aaacatgtatattgaataataatgatagaattgaattcataaaatatagacctgttttttccaattcgtaagagatgtaatgatggagagaaaaattgtt |
31755483 |
T |
 |
| Q |
208 |
tggacaatggagccagcaactattccaatccaaaggccctttgctt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31755484 |
tggacaatggagccagcaactattccaatccaaaggccctttgctt |
31755529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 31755344 - 31755383
Alignment:
| Q |
30 |
atgattgcctacaaaagttgcatttatcttgtattattaa |
69 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31755344 |
atgattgcctacaaaagttgcatttaccttgtattattaa |
31755383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University