View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_221 (Length: 252)
Name: NF1345_high_221
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_221 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 15981746 - 15981989
Alignment:
| Q |
9 |
tcgaagaatatcaaagttgacagggttgaagtgcaaccttctaacggtcaagtagatagtgtgtctattcatgtccacgacaacatgacaagtgataaga |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15981746 |
tcgaaggatatcaaagttgacagggttgaagtgcaaccttctaacgatcaagtagatagtgtgtctattcatgtccacgacaacatgacaagcgataaga |
15981845 |
T |
 |
| Q |
109 |
attcggataagttgtttgttcatttgagtaaatccagtgatgctgataatatcagtcagtgtagttcgatttatcaccacgagagaggattaagtttaat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15981846 |
attcggataagttgtttgttcatttgagtaaatccagtgatcctgataatatcagtcagtgtagttcgatttatcaccacgagagaggattaagtttaat |
15981945 |
T |
 |
| Q |
209 |
atcagcagaggatggaaactttggaactgttaagaagcagtata |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15981946 |
atcagcagaggatggaaactttggaactgttaagaagcagtata |
15981989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University