View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_224 (Length: 251)
Name: NF1345_high_224
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_224 |
 |  |
|
| [»] scaffold0361 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0361 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: scaffold0361
Description:
Target: scaffold0361; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 12366 - 12131
Alignment:
| Q |
16 |
ataaaataaaatttaatatgttgaaaaccagtttggttcagcattgaaacgctagtgcaccgaatcacgtaaccagtctggcttggttcaggtgaaacaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12366 |
ataaaataaaatttaatatgttgaaaaccagtttggttcagcattgaaacgctagtgcaccgaatcacgtaaccagtctggcttggttcaggtgaaacaa |
12267 |
T |
 |
| Q |
116 |
ttgcagtttggttcggttttctctgactgcttttgtggttcggtttgctcgttaaaccaaactatgtaaaagcctagcctttgtagctttcctccctttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12266 |
ttgcagtttggttcggttttctctgactgcttttgtggttcggtttgctcgttaaaccaaactatgtaaaagcctagcctttgtagctttcctccctttt |
12167 |
T |
 |
| Q |
216 |
ttcattgaaaggggatggctagatgataggccatta |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12166 |
ttcattgaaaggggatggctagatgataggccatta |
12131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 4947727 - 4947504
Alignment:
| Q |
16 |
ataaaataaaatttaatatgttgaaaaccagtttggttcagcattgaaacgctagtgcaccgaatcacgtaaccagtctggcttggttcaggtgaaacaa |
115 |
Q |
| |
|
|||| |||||||||||| || ||||||||||||||||||||||||||||| |||||||| ||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
4947727 |
ataacataaaatttaatctgctgaaaaccagtttggttcagcattgaaaccatagtgcactgaatcacataaccagtttggtttggttcaggtgaaacaa |
4947628 |
T |
 |
| Q |
116 |
ttgcagtttggttcggttttctctgactgcttttgtggttcggtttgctcgttaaaccaaactatgtaaaagcctagcctttgtagctttcctccctttt |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
4947627 |
ttgcagtttggttcggttttctctggctgcttttgtggttcggttttctcgtaaaaccaaactatgtaaaagcctagtctttgtagctttccttcctttt |
4947528 |
T |
 |
| Q |
216 |
ttcattgaaaggggatggctagat |
239 |
Q |
| |
|
| |||||||||||||| ||||||| |
|
|
| T |
4947527 |
tccattgaaaggggatagctagat |
4947504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University