View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_235 (Length: 248)
Name: NF1345_high_235
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_235 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 35106372 - 35106154
Alignment:
| Q |
1 |
caatgatttcactcgataaaagag--agtgttcgatagtgttgnnnnnnngatgtttctaacacttctttatatatattgttccctacacaacagcacgc |
98 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
35106372 |
caatgatttcactcaataagagagcgagtgttcgataatgttgaaaaaaagatgtttctaacacttctttatat----tgttccctacacaacagcaccc |
35106277 |
T |
|
| Q |
99 |
gggcatacacccaaatattattttcgtacaaataacacaaaaattgtcgtccaacttatgcattatcataattttactctaatgtctcggtcgctaaaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35106276 |
gggcatacacccaaatattattttcgtacaaataacacaaaaattgtcgtccaacttatgcattatcataattttactctaatgtctcggtcgctaaaat |
35106177 |
T |
|
| Q |
199 |
actatgtttttcaccatggaaat |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35106176 |
actatgtttttcaccatggaaat |
35106154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University