View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_242 (Length: 243)
Name: NF1345_high_242
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_242 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 42797494 - 42797702
Alignment:
| Q |
1 |
aacaaaggacactaatcttataaaggctaaatatcgggatttggaaaccaccacatgtgattatattgagttagacacaacaaacaaaaatgaccaaacg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42797494 |
aacaaaggacactaatcttctaaaggctaaatatcgggatttggaaacaaccacatgtgattatattaagttagacacaacaaacaaaaatgaccaaacg |
42797593 |
T |
 |
| Q |
101 |
atcgaaagagaagaaacaaagggtgagcctgcaaatagagaaagaaaatgtattccaacgaattggtaaaattgaacaaggatattgaactatcaaaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
42797594 |
atcgaaagagaagaaacaaagggtgagcctgcaaatagagaaagaaaatgtattccaacgaattggtaga-------------attgaactatcaaaaac |
42797680 |
T |
 |
| Q |
201 |
ttctttggaagataagatgtgt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42797681 |
ttctttggaagataagatgtgt |
42797702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University