View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_249 (Length: 239)
Name: NF1345_high_249
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_249 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 162 - 239
Target Start/End: Complemental strand, 353858 - 353781
Alignment:
| Q |
162 |
caaccaaacaagctgtcgatactgacatgatagccaagtctttaaaattcttggaatgtgattgagtgagttttctat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
353858 |
caaccaaacaagctgtcgatactgacatgatagccaagtctttaaaattcttggaatgtgattgagtgagttttctat |
353781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 162 - 228
Target Start/End: Complemental strand, 24579053 - 24578987
Alignment:
| Q |
162 |
caaccaaacaagctgtcgatactgacatgatagccaagtctttaaaattcttggaatgtgattgagt |
228 |
Q |
| |
|
|||||||||||| || ||| ||||| |||||| |||||||| | |||| |||||||||||||||||| |
|
|
| T |
24579053 |
caaccaaacaagatgccgagactgagatgataaccaagtctctcaaatacttggaatgtgattgagt |
24578987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University