View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_253 (Length: 230)
Name: NF1345_high_253
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_253 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 47125631 - 47125408
Alignment:
| Q |
7 |
atcttgagacctgatgttagacttaggagtctcacattgagaagtattagctaaataggtctctaacctaataggaaaatcttttaaattggcctttctc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47125631 |
atcttgagacctgatgttagacttaggagtctcacattgagaagtattagctaaataggtctctaacctaataggaaaatcttttaaattggcctttctc |
47125532 |
T |
|
| Q |
107 |
tttgggcttatgctcataatattgattatttactagagaggattgactatttggaaaacactatccgtaaaggattctgaccgttggagggttttaacca |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47125531 |
tttgggcttatgctcataacattgattatttactagagaggattgactatttggaaaacactatccgtaaaggattctgaccgttggagggttttaacca |
47125432 |
T |
|
| Q |
207 |
aataaatttagacgaggagcacca |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47125431 |
aataaatttagacgaggagcacca |
47125408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University