View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_254 (Length: 229)
Name: NF1345_high_254
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_254 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 18 - 141
Target Start/End: Original strand, 29838680 - 29838803
Alignment:
| Q |
18 |
gttccattttgccacaatccgataatgtgaaatttaatcttttggtatcgactgatagaaagcagacgaacttctattgatatcttcttaaaggcttctg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838680 |
gttccattttgccacaatccgataatgtgaaatttaatcttttggtatcgactaatagaaagcagacgaacttctattgatatcttcttaaaggcttctg |
29838779 |
T |
|
| Q |
118 |
gatatctggattgcgcagtcaaac |
141 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29838780 |
gatatctggattgcgcagtcaaac |
29838803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University