View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_260 (Length: 224)
Name: NF1345_high_260
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_260 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 8716477 - 8716608
Alignment:
| Q |
1 |
tcaagtggctgctggacgaagacaaaggattctcgttcaaaacctgctatagtcttctgcttgaccttcacttttctgc------tgatgcaaaattttt |
94 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
8716477 |
tcaagtggctgctggacgaagacaacggattctcgttcaaaacctgctatagtctgctgcttgatcttcacttttctgctgatgatgatgcaaaattttt |
8716576 |
T |
 |
| Q |
95 |
gacagcagctcggagttttgtgggacacatca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8716577 |
gacagcagctcggagttttgtgggacacatca |
8716608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University