View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_261 (Length: 223)
Name: NF1345_high_261
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_261 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 33 - 204
Target Start/End: Complemental strand, 33422795 - 33422624
Alignment:
| Q |
33 |
gagtgagatgaattcacaaagtgtaaaggttaattacctaatctgcaaatcacttgtcacaaagtgtaaagatttaattactactcatgaaagcattgtc |
132 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33422795 |
gagtgaaatgaattcacaaagtgtaaaggttaattacctaatctgcaaatcacttgtcacaaagtgtaaagatttaattactactcatgaaagcattgtc |
33422696 |
T |
 |
| Q |
133 |
acttgtcttttgtcggtttagataatggctttgaatatggttttggcccacttgtagtcctgtagccatgtg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33422695 |
acttgtcttttgtcggtttagataatggctttgaatatggttttggcccacttgtagtcctgtagccatgtg |
33422624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University