View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_265 (Length: 219)
Name: NF1345_high_265
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_265 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 43195736 - 43195552
Alignment:
| Q |
20 |
tgaaaatatcaaagtctaacaatatccacatttgttaaataagcccataaatatctaaataataattttgttttggtatattgtctaaatcatttctaca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43195736 |
tgaaaatatcaaagtctaacaatatccacatttgttaaataagcccataaatatctaaataataattttattttggtatattgtctaaatcatttctaca |
43195637 |
T |
|
| Q |
120 |
aaagtcacacactacgtttttcttgtcctaattaaagtaattttccttgcacctgttaaatgaccttgaccatgcatgttaatga |
204 |
Q |
| |
|
||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195636 |
aaattcacatactacgtttttcttgtcctaaataaagtaattttccttgcacctgttaaatgaccttgaccatgcatgttaatga |
43195552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University