View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_40 (Length: 524)
Name: NF1345_high_40
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 28 - 431
Target Start/End: Complemental strand, 32616808 - 32616405
Alignment:
| Q |
28 |
cacaactctcatgcttgggctcttggttgggatacaagactctttgccccagcttacgcggttagtgttttgnnnnnnnatggatagaaccatagaattc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32616808 |
cacaactctcatgcttgggctcttggttgggatacaagactctttgccccagcttacgcggttagtgttttgtttttttatggatagaaccatagaattc |
32616709 |
T |
 |
| Q |
128 |
aactttcgagtttagaatacacagatgcactatgcaccaaccacttgcactatttggacacaatacaagtattgcttctcaagtatcattaaacaannnn |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32616708 |
aactttcgagtttagaatacacagatgcactacgcaccaaccacttgcgctatttggacacaatacaagtattgcttctcaagtatgattaaacaatttt |
32616609 |
T |
 |
| Q |
228 |
nnnnnnnnnnnnnnngtgattgattattacagggaatagttacatcaggagtgcagtattacatacaaggtctggttataaaaactatgggaccagttat |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616608 |
ttttcttccttttttgtgattgattattacagggaatagttacatcaggagtgcagtattacatacaaggtctggttataaaaactatgggaccagttat |
32616509 |
T |
 |
| Q |
328 |
tgtaactgcttttaatcctgtacgtatgatcatcgtaacggccctggcttgcatcatcctctctgaacaactttttcttggaaggtactgttctgtgcta |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616508 |
tgtaactgcttttaatcctgtacgtatgatcatcgtaacggccctggcttgcatcatcctctctgaacaactttttcttggaaggtactgttctgtgcta |
32616409 |
T |
 |
| Q |
428 |
agca |
431 |
Q |
| |
|
|||| |
|
|
| T |
32616408 |
agca |
32616405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 414
Target Start/End: Complemental strand, 10624166 - 10624060
Alignment:
| Q |
308 |
aaaactatgggaccagttattgtaactgcttttaatcctgtacgtatgatcatcgtaacggccctggcttgcatcatcctctctgaacaactttttcttg |
407 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||||||| | |||||||| || || || ||| ||||||| || |||||||||| |||| ||||| |
|
|
| T |
10624166 |
aaaactatgggacctgtttttgtgactgcttttaatcctttgcgtatgattatagtcacagccttggcttgtattgtcctctctgagaaactccatcttg |
10624067 |
T |
 |
| Q |
408 |
gaaggta |
414 |
Q |
| |
|
||||||| |
|
|
| T |
10624066 |
gaaggta |
10624060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University