View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_high_98 (Length: 417)
Name: NF1345_high_98
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_high_98 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 7e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 30 - 177
Target Start/End: Complemental strand, 35517684 - 35517538
Alignment:
| Q |
30 |
tataatgcattaattgttatttaagtataagaatacatttcatactagcaaaaagttagattatagcttatttgaccagctagttataagtttgtttaaa |
129 |
Q |
| |
|
||||||||||||||||| |||||| |||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
35517684 |
tataatgcattaattgtcatttaattataaggatacatttcatactagcaataagttagattatagcttatttgactagctagttataagtttgttt-aa |
35517586 |
T |
|
| Q |
130 |
aatgtggtcgataacaagcttcttttactagtttatagtttctcttga |
177 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35517585 |
aatgtggtcggtaacaagcttcttttactagtttatagtttctcttga |
35517538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University