View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_103 (Length: 417)

Name: NF1345_low_103
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_103
NF1345_low_103
[»] chr7 (1 HSPs)
chr7 (30-177)||(35517538-35517684)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 7e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 30 - 177
Target Start/End: Complemental strand, 35517684 - 35517538
Alignment:
30 tataatgcattaattgttatttaagtataagaatacatttcatactagcaaaaagttagattatagcttatttgaccagctagttataagtttgtttaaa 129  Q
    ||||||||||||||||| |||||| |||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| ||    
35517684 tataatgcattaattgtcatttaattataaggatacatttcatactagcaataagttagattatagcttatttgactagctagttataagtttgttt-aa 35517586  T
130 aatgtggtcgataacaagcttcttttactagtttatagtttctcttga 177  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||    
35517585 aatgtggtcggtaacaagcttcttttactagtttatagtttctcttga 35517538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University