View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_123 (Length: 382)
Name: NF1345_low_123
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_123 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 28 - 190
Target Start/End: Complemental strand, 26912982 - 26912820
Alignment:
| Q |
28 |
atgaagagtggtgattgtatttatataagagtcttccaatttaaaatgaaaagaaaacaatggaaggttttagtgaatgattgcgattgctgtttggggc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26912982 |
atgaagagtggtgattgtatttatataagagtcttccaatttgaaatgaaaagaaaacaatggaaggttttagtgaatgattgcgattgctgtttggggc |
26912883 |
T |
|
| Q |
128 |
ggacgtacttctgtttcagtcacaatactatttctccttttttcttgcgtcattaacccattc |
190 |
Q |
| |
|
|||||||||| |||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26912882 |
ggacgtactttagtttcactcacaatactgcttctccttttttcttgcgtcattaacccattc |
26912820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 332 - 374
Target Start/End: Complemental strand, 26912674 - 26912632
Alignment:
| Q |
332 |
ccatagtgaaattagtataaattacctttaatttattctctct |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26912674 |
ccatagtgaaattagtataaattacctttaatttattctctct |
26912632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 208 - 243
Target Start/End: Complemental strand, 26912803 - 26912768
Alignment:
| Q |
208 |
aatgtgtactggctagctaggtcccaacttataatt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
26912803 |
aatgtgtactggctagctaggtcccaacttataatt |
26912768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University