View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_124 (Length: 380)
Name: NF1345_low_124
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_124 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 28 - 352
Target Start/End: Complemental strand, 32616808 - 32616484
Alignment:
| Q |
28 |
cacaactctcatgcttgggctcttggttgggatacaagactctttgccccagcttacgcggttagtgttttgnnnnnnnatggatagaaccatagaattc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32616808 |
cacaactctcatgcttgggctcttggttgggatacaagactctttgccccagcttacgcggttagtgttttgtttttttatggatagaaccatagaattc |
32616709 |
T |
|
| Q |
128 |
aactttcgagtttagaatacacagatgcactatgcaccaaccacttgcactatttggacacaatacaagtattgcttctcaagtatcattaaacaannnn |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32616708 |
aactttcgagtttagaatacacagatgcactacgcaccaaccacttgcgctatttggacacaatacaagtattgcttctcaagtatgattaaacaatttt |
32616609 |
T |
|
| Q |
228 |
nnnnnnnnnnnnnnngtgattgattattacagggaatagttacatcaggagtgcagtattacatacaaggtctggttataaaaactatgggaccagttat |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616608 |
ttttcttccttttttgtgattgattattacagggaatagttacatcaggagtgcagtattacatacaaggtctggttataaaaactatgggaccagttat |
32616509 |
T |
|
| Q |
328 |
tgtaactgcttttaatcctgtacgt |
352 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32616508 |
tgtaactgcttttaatcctgtacgt |
32616484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University