View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_128 (Length: 375)
Name: NF1345_low_128
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_128 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 49 - 297
Target Start/End: Original strand, 41068915 - 41069163
Alignment:
| Q |
49 |
actatgattgactaatctttagtgcaacaacttgtccattaatctatcactcccctacagtgaacaccatgttatggtgatggggtcattaggaaaagaa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41068915 |
actatgattgactaatctttagtgcaacaacttgtccattaatctatcactcccctacagtgaacaccatgttatggtgatggggtcattaggaaaagaa |
41069014 |
T |
 |
| Q |
149 |
aacgaatttgaattagaatttacatgacccatgaaggaccacaaagtgtgactaataatctaaaacacccttccatgaaaaatatgctacctcatttctc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41069015 |
aacgaatttgaattagaatttacatgacccatgaaggaccacaaagtgtgactaatcatctaaaacacccttccaagaaaaatatgctacctcatttctc |
41069114 |
T |
 |
| Q |
249 |
tgtatctgcttagtttgaacatcttctcatgaatccatgatcaccttgg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41069115 |
tgtatctgcttagtttgaacatcttctcatgaatccatgatcaccttgg |
41069163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University