View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_13 (Length: 690)
Name: NF1345_low_13
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 2e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 2e-82
Query Start/End: Original strand, 12 - 175
Target Start/End: Complemental strand, 38423060 - 38422897
Alignment:
| Q |
12 |
ataggtgatatgaataattttattcacgttaacaatagtttaataataaaaattgtccaagtaattgtaagctattttttattatagattaccaatagaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38423060 |
ataggtgatatgaataattttattcacgttaacaatagtttaataataaaaattgtccaagtaattgtaagctatttttttttatagattaccaatagaa |
38422961 |
T |
|
| Q |
112 |
attatatgtgtgtttaaactcctcaagaacattgtgaatctcatctaaagtgatgcggtagaaa |
175 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38422960 |
attatatgtgtgtttaaactcctcaaaaacattgtgaatctcatctaaagtgatgcggtagaaa |
38422897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 250 - 287
Target Start/End: Complemental strand, 38422737 - 38422700
Alignment:
| Q |
250 |
attgtacacaacggaaaaactacgcatatatgattatg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38422737 |
attgtacacaacggaaaaactacgcatatatgattatg |
38422700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University