View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_130 (Length: 373)
Name: NF1345_low_130
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_130 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 58 - 302
Target Start/End: Complemental strand, 42954007 - 42953763
Alignment:
| Q |
58 |
gaattaaaatataatacgaatattgaaatggtgattatgtaccatggatgagagcagtcaaatgtaaccaatcttcattaggataatcttttctaatagc |
157 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42954007 |
gaattaaaatataatacgaatattgaaaaggtgattatgtaccatggatgagagcagtcaaatgtaaccaatcttcattaggataatcttttctaatagc |
42953908 |
T |
|
| Q |
158 |
ttcagcagattgcagcaaatgttgaatttgtggttcatccaaatcaggatcactttcatccacaacctcatttagcaattcacaacattcccaaatgctc |
257 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42953907 |
ttcagcggattgcagcaaatgttgaatttgtggttcatccaaatcaggatcactttcatccacaacctcatttagcaattcacaacattcccaaatgctc |
42953808 |
T |
|
| Q |
258 |
atttctgctttgtctaattttttgtattcctccctcatattcttc |
302 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
42953807 |
atttctgctttgtctagttttttgtattcctccctcattttcttc |
42953763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 96 - 259
Target Start/End: Original strand, 4936386 - 4936549
Alignment:
| Q |
96 |
gtaccatggatgagagcagtcaaatgtaaccaatcttcattaggataatcttttctaatagcttcagcagattgcagcaaatgttgaatttgtggttcat |
195 |
Q |
| |
|
||||||||||| || |||| || || | |||||||||||| || || || ||||| ||||||||||| | ||| |||||||| | |||||||||||||| |
|
|
| T |
4936386 |
gtaccatggattaggccagttaagtgcagccaatcttcatttgggtagtcctttcttatagcttcagctgtttgtagcaaatgctcaatttgtggttcat |
4936485 |
T |
|
| Q |
196 |
ccaaatcaggatcactttcatccacaacctcatttagcaattcacaacattcccaaatgctcat |
259 |
Q |
| |
|
|||| ||||| |||||||||||||| || ||||| || | ||||||||||||||| |||||||| |
|
|
| T |
4936486 |
ccaagtcagggtcactttcatccaccacttcattcagaagttcacaacattcccatatgctcat |
4936549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University