View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_135 (Length: 362)

Name: NF1345_low_135
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_135
NF1345_low_135
[»] chr4 (1 HSPs)
chr4 (119-352)||(54773569-54773802)


Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 119 - 352
Target Start/End: Complemental strand, 54773802 - 54773569
Alignment:
119 gttattggagggaataaagcctgatccagtcacgtttgtgaatcttctctctgcctgtagtcatatgggactggtggatagaggctgggagtatttcaag 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54773802 gttattggagggaataaagcctgatccagtcacgtttgtgaatcttctctctgcctgtagtcatatgggactggtggatagaggctgggagtatttcaag 54773703  T
219 atgatgtttgatgagtttaacattgctccgatggtagagcattatgcttgcatggttgacatcttaagccgtgcaggcaagctcaatgaagctaaagagt 318  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54773702 atgatgtttgatgagtttaacattgctccgatggtagagcattatgcttgcatggttgacatcttaagccgtgcaggcaagctcaatgaagctaaagagt 54773603  T
319 tcattgaatctgcaacggttgatcacggtctgtg 352  Q
    ||||||||||||||||||||||||||||||||||    
54773602 tcattgaatctgcaacggttgatcacggtctgtg 54773569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University