View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_149 (Length: 339)
Name: NF1345_low_149
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_149 |
 |  |
|
| [»] scaffold0425 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0425 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: scaffold0425
Description:
Target: scaffold0425; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 26 - 304
Target Start/End: Complemental strand, 4368 - 4084
Alignment:
| Q |
26 |
gctttgcaacacaacttctgtgccgcactgttgttcctgcacattcacgaccacggcaacaaatctgtctttgctagatccaccctctcccgacgccaaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4368 |
gctttgcaacacaacttctgtgccgcactgttgttcctgcacattcacgaccacggcaacaaatctgtctttgctagatccaccctctcccgacgccaaa |
4269 |
T |
 |
| Q |
126 |
ttaaatctaagaaatttcaagattaatctttgaaattatctttgaatttcacaccttgataagatgagttcatggacaaatttcagaaataaaagttgtt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4268 |
ttaaatctaagaaatttcaagattaatctttgaaattatctttgaatttcacaccttgataagatgagttcatggacaaa-ttcagaaataaaagttgtt |
4170 |
T |
 |
| Q |
226 |
taggtagttttgaggggaactgc-------agtccatcattgaaaatgaaaacagagtgagccaatgttaagcttgaagctttaat |
304 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4169 |
taggtagttttgaggggaactacatatataagtccatcgttgaaaatggaaacagagtgagccaatgttaagcctgaagctttaat |
4084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 6852505 - 6852446
Alignment:
| Q |
26 |
gctttgcaacacaacttctgtgccgcactgttgttcctgcacattcacgaccacggcaac |
85 |
Q |
| |
|
||||||||||||||||| |||||| || || |||||||||||||||||||||| |||||| |
|
|
| T |
6852505 |
gctttgcaacacaacttttgtgccacagtgctgttcctgcacattcacgaccatggcaac |
6852446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University