View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_150 (Length: 339)
Name: NF1345_low_150
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_150 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 38397827 - 38397748
Alignment:
| Q |
1 |
ttaacaagaaaaataaatggttgagttgaagtgaaaagttaaaacacaaataacaatattataaagcttgatataataat |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38397827 |
ttaacaagaaaaataaatggttgagttgaagtgaaaagttaaaacacaaataacaatattataaagcttgatataataat |
38397748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 225 - 310
Target Start/End: Complemental strand, 38397603 - 38397516
Alignment:
| Q |
225 |
cctagttagactcaaagatgtaaatgagagtgtgtgt--tagcttgtaattggatgaaagaaaaatgagacatgagttaggttgtctg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38397603 |
cctagttagactcaaagatgtaaatgagtgtgtgtgtgttagcttgtaattggatgaaagaaaaatgagacatgagttaggttgtctg |
38397516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University