View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_158 (Length: 334)
Name: NF1345_low_158
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_158 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 93 - 326
Target Start/End: Original strand, 34966444 - 34966677
Alignment:
| Q |
93 |
ttcaaaacatggttattccaagacatataaacctcttagttggttgttgagtctcaacaccatctcatgaactaagcacattaggaatttaaaatctttg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34966444 |
ttcaaaacatggttattccaagacatataaacctcttagttggttgttgagtctcaacaccatctcatgaactaagcacattaggaatttaaaatctttg |
34966543 |
T |
 |
| Q |
193 |
gtaactttccaagttatttttgggacttgagacataatttccccaagttttttgctcttcatatcttcaatgtactttgtctcgttgcttccataatttc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34966544 |
gtaactttccaagttatttttgggacttgagacataatttccccaagttttttgctcttcatatcttcaatgtactttgtctcgttgcttccataatttc |
34966643 |
T |
 |
| Q |
293 |
tatatggcatcgttgtttggatcaatcctatgat |
326 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |
|
|
| T |
34966644 |
tacatggcatcgttgtttggatcaatcctatgat |
34966677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 263
Target Start/End: Original strand, 20697659 - 20697706
Alignment:
| Q |
216 |
gacttgagacataatttccccaagttttttgctcttcatatcttcaat |
263 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
20697659 |
gacttgagacataattttcccaatttttttgcacttcatatcttcaat |
20697706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 244 - 297
Target Start/End: Original strand, 43060031 - 43060085
Alignment:
| Q |
244 |
ttgctcttcatatcttcaatgtactttgtct-cgttgcttccataatttctatat |
297 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||||||||| |||||||| |
|
|
| T |
43060031 |
ttgctcttcatatcttcaatgtacttgctctgccttgcttccataacttctatat |
43060085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University