View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_162 (Length: 331)
Name: NF1345_low_162
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_162 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 97 - 272
Target Start/End: Complemental strand, 40206002 - 40205827
Alignment:
| Q |
97 |
gatcatccagggtcctacaaatatactatagaggatggaggctgcaaaattgaacgttggcatagatgggaagtcccatccatgatcagcacatcacatc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40206002 |
gatcatccagggtcctacaaatatactatagaggatggaggctgcaaaattgaacgttggcatagatgggaagtcccatccatgatcagcacatcacatc |
40205903 |
T |
 |
| Q |
197 |
ctgaaattaataagatagttgctatacaacatgacccaataaaaccaaccccaccagcttcagcccccttcatctc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40205902 |
ctgaaattaataagatagttgctatacaacatgacccaataaaaccaaccccaccagcttcagcccccttcttctc |
40205827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University