View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_170 (Length: 318)
Name: NF1345_low_170
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_170 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 44 - 285
Target Start/End: Original strand, 286388 - 286629
Alignment:
| Q |
44 |
gattctattcattcacgcttgattgagatagatgaagataatgatgtaagagaggtggttttacctggtggagtttcattaccaaatgtttccaaattaa |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
286388 |
gattctattcattcacgcttgattgagatagatgaagataatgatttaagagaggtggttttacctggtggagtttcattaccaaatgtttccaaattaa |
286487 |
T |
|
| Q |
144 |
tcaaatgtgataaaggtgaacgcaccaggttcaggtctgatgttttgtcttttcaacaggtaaactaacaaaaacagcttatgtcctacttgctttgctt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
286488 |
tcaaatgtgataaaggtgaacgcaccaggttcaggtctgatgttttgtcttttcaacaggtaaactttcaaaaacatcttatttcctacttgctttgctt |
286587 |
T |
|
| Q |
244 |
tcccggaagtgattacatttcttcttgtctctctttcaccag |
285 |
Q |
| |
|
||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
286588 |
gccctgcagtgattacatttcttcttgtctctctttcaccag |
286629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University