View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_177 (Length: 310)
Name: NF1345_low_177
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_177 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 30 - 299
Target Start/End: Complemental strand, 9496417 - 9496134
Alignment:
| Q |
30 |
agaattggatatgtatgtgaatcaccagccttcccttcaatttctccaggtaagttattacccaaagaactagaagcatcatcatccactgctgcatctg |
129 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9496417 |
agaattggatatggatgtgaatcaccagccttcccttcaatttctccaggtaagttattacccaaagaactagaagcatcatcatccactgctgaatctg |
9496318 |
T |
|
| Q |
130 |
taactgatgaagaatgcaacactttcccaggtacatcattaccagacattacataa--------------cccagtccctacaggatcaaagggagagca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9496317 |
taactgatgaagaatgcaacactttcccaggtacatcattaccagacattacataaccaacagtctgggtcccagtccctacaggatcaaagggagagca |
9496218 |
T |
|
| Q |
216 |
aaatgttgcagctgttggagatgctaaaccatttgtactatatgaagaagagaaagcaaccatatcatccactgtcctattcat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496217 |
aaatgttgcagctgttggagatgctaaaccatttgtactatatgaagaagagaaagcaaccatatcatccactgtcctattcat |
9496134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University