View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_181 (Length: 304)
Name: NF1345_low_181
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_181 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 156 - 283
Target Start/End: Complemental strand, 39100253 - 39100127
Alignment:
| Q |
156 |
gtagcattcaaagaacttcattctgtataaaacatgttgtatcacgtaaaacccttcaaaaaattctgtatctgcatgttgtacaaggtggcaacgggca |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39100253 |
gtagcattcaaagaacttcattctgtataaaacatgttgtatcacgtaaaacccttcaaaaaattctgtatctgcatgttgtacaaggtggcaacgggca |
39100154 |
T |
 |
| Q |
256 |
acatcctcatttttattatatcatcctc |
283 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
39100153 |
acatcctca-ttttattatatcatcctc |
39100127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 30 - 145
Target Start/End: Complemental strand, 39100473 - 39100356
Alignment:
| Q |
30 |
gcttctgttttcacttttaatttgctcgtgctcataagaattatatagatnnnnnnnnnn--tatagaatccttttttagaataaaacttcaatttgact |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39100473 |
gcttctgttttcacttttaatttgctcgtgctcataagaattatatagataaaaaataataatatagaatccttttttagaataaaacttcaatttgact |
39100374 |
T |
 |
| Q |
128 |
gagtttgcttgttcaact |
145 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39100373 |
gagtttgcttgttcaact |
39100356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University