View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_186 (Length: 302)
Name: NF1345_low_186
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_186 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 84 - 302
Target Start/End: Complemental strand, 9772360 - 9772142
Alignment:
| Q |
84 |
ttgtgctataccccatctccaatactgttttaagtgttcatggttggatgagctttcacttttcaaagaaaaatatggatctgttaccagcatacttcgt |
183 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9772360 |
ttgtactataccccatctccaatactgttttaagtgttcatggttggatgagctttcacttttcaaagaaaaatatggatctgttaccagcatacttcgc |
9772261 |
T |
|
| Q |
184 |
gtcgcagagctcaagcatgacataagcaatttggagctgataatcaaacatcttcgagaaggcctggaaattttgaacgaggagatcgaaaaaacacttg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
9772260 |
gtcgcagagctcaagcatgacataagcaatttggagctgataatcaaacatcctcgagaaggcctggaaattttgaatgaggaaatcgaaaaaacacttg |
9772161 |
T |
|
| Q |
284 |
cggagctcaaagaaattaa |
302 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
9772160 |
cggagctcaaagaaattaa |
9772142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University