View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_187 (Length: 302)
Name: NF1345_low_187
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_187 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 49 - 231
Target Start/End: Original strand, 582334 - 582516
Alignment:
| Q |
49 |
agtgagatgaaagagacatatgaatatcttacatcaggtggaacattgaataccacattaaggttgattattttgtttcctttgttggatagagatccaa |
148 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
582334 |
agtgagattaaagagacatatgaatatcttacatcaggtggaacattgaataccacattaaggttgattattttgtttcctttgttggatagagatccaa |
582433 |
T |
 |
| Q |
149 |
aagatgggtttgttggttttaatgaattagaaagttgggttactcaaagggctttggagagattggattatgctacacaagtt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
582434 |
aagatgggtttgttggttttaatgaattagaaagttgggttactcaaagggctttggagagattggattatgctacacaagtt |
582516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University