View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_188 (Length: 299)
Name: NF1345_low_188
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_188 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 6e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 156 - 234
Target Start/End: Original strand, 44959814 - 44959892
Alignment:
| Q |
156 |
cggaaaccggacgataaggactaagaccagcaagcatactcaaatgtccttcattcatattcatattcatattgatatt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44959814 |
cggaaaccggacgataaggactaagaccagcaagcatactcaaatgtccttcattcatattcatattcatattgatatt |
44959892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 39 - 104
Target Start/End: Original strand, 44959697 - 44959762
Alignment:
| Q |
39 |
gatgatgatcttgtaggagctgtgattaattatcatgtcgatcatcgtgttcatggctaccactgc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44959697 |
gatgatgatcttgtaggagctgtgattaattatcatgtcgatcatcgtgttcatggctaccactgc |
44959762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University