View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_191 (Length: 296)
Name: NF1345_low_191
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_191 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 99 - 180
Target Start/End: Complemental strand, 42095228 - 42095147
Alignment:
| Q |
99 |
gtggatatttttcgaaggggaaggggcactcataatctcaagttcgactaatgttgtttcaattttactattttcatctcac |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
42095228 |
gtggatatttttcgaaggggaaggggcactcataatctcaagttcgactaatgttgtttcaattttactatttccttctcac |
42095147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University