View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_203 (Length: 282)
Name: NF1345_low_203
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_203 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 92 - 277
Target Start/End: Original strand, 10417497 - 10417681
Alignment:
| Q |
92 |
atgaattttcttctgttcacactcaaaagcaaaagnnnnnnnnaagagtgaaggaagcaattatgtcctctccacccactgaccacttacccnnnnnnnn |
191 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10417497 |
atgaattttcttctgttcagactcaaaagcaaaagttttttt-aagagtgaaggaagcaattatgtcctctccacccactgaccacttacccttttcttt |
10417595 |
T |
 |
| Q |
192 |
nnnnnnnnnnnnnnncgtacaaaatcctttttcttatcacaaattcattaattcatcagttgaacttttttgctttctgtggtgct |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10417596 |
atcttttttaatttttgtacaaaatcctttttcttatcacaaattcattaattcatcagttgaacttttttgctttttgtggtgct |
10417681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 71
Target Start/End: Original strand, 10417454 - 10417496
Alignment:
| Q |
29 |
accaatatctttttgtaagtaattctgatgtaaccttttgttc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10417454 |
accaatatctttttgtaagtaattctgatgtaaccttttgttc |
10417496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University