View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_206 (Length: 282)
Name: NF1345_low_206
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_206 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 254
Target Start/End: Original strand, 31929390 - 31929628
Alignment:
| Q |
16 |
ataaggtgggaaaaggaatgctctaataattgaccgttcttgtgggtattgtgaagttctttatgggcccatattgagaggtttaggacataaggcaaca |
115 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31929390 |
ataaggtggaaaaagtaatgctctaataattgaccgttcttgtgggtattgtgaagttctttatgggcccatattgagaggtttaggacataaggcaaca |
31929489 |
T |
 |
| Q |
116 |
taagaaaattgctttttagactaaacgttttgctatggcatacatgtaaatgacattcaatatccgcaactgtagttaactacacttcattgtttaannn |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31929490 |
taagaaaattgctttttagactaaacgttttgctatggcatacatgtaaatgacatttaatatccgcaactgtagttaactacacttcattgcttaattt |
31929589 |
T |
 |
| Q |
216 |
nnnnggaacgaacggtagttaactaccgttaaagtattt |
254 |
Q |
| |
|
||| ||||||||| ||||||| ||||||||||||| |
|
|
| T |
31929590 |
ttttggagcgaacggtaattaactatcgttaaagtattt |
31929628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University