View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_208 (Length: 282)

Name: NF1345_low_208
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_208
NF1345_low_208
[»] chr6 (2 HSPs)
chr6 (101-282)||(3535604-3535786)
chr6 (70-108)||(3542334-3542372)


Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 101 - 282
Target Start/End: Complemental strand, 3535786 - 3535604
Alignment:
101 agcaaactcacgtagacctaattttcgcagtttagagatgagaataaggaatggaaccgaaatgagttctaagctaagacacgtcaaaatctatgtgacg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||    
3535786 agcaaactcacgtagacctaattttcgcagtttagagatgagaataaggaatggaaccgaaatgagttctaagctatgacacgtcagaatctatgtgacg 3535687  T
201 tggcggaaatagtattacatgactcttccattgtggatgatcggattacg-ttttttgctctaaaagattagacatagttgca 282  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||    
3535686 tggtggaaatagtattacatgactcttccattgtggatgatcggattacgattttctgctctaaaagattagacatagttgca 3535604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 70 - 108
Target Start/End: Complemental strand, 3542372 - 3542334
Alignment:
70 accaactgtgagtaaaaagacactggtgcagagcaaact 108  Q
    ||||||||||||| |||||||||||||||||||||||||    
3542372 accaactgtgagtcaaaagacactggtgcagagcaaact 3542334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University