View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_208 (Length: 282)
Name: NF1345_low_208
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_208 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 101 - 282
Target Start/End: Complemental strand, 3535786 - 3535604
Alignment:
| Q |
101 |
agcaaactcacgtagacctaattttcgcagtttagagatgagaataaggaatggaaccgaaatgagttctaagctaagacacgtcaaaatctatgtgacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
3535786 |
agcaaactcacgtagacctaattttcgcagtttagagatgagaataaggaatggaaccgaaatgagttctaagctatgacacgtcagaatctatgtgacg |
3535687 |
T |
 |
| Q |
201 |
tggcggaaatagtattacatgactcttccattgtggatgatcggattacg-ttttttgctctaaaagattagacatagttgca |
282 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
3535686 |
tggtggaaatagtattacatgactcttccattgtggatgatcggattacgattttctgctctaaaagattagacatagttgca |
3535604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 70 - 108
Target Start/End: Complemental strand, 3542372 - 3542334
Alignment:
| Q |
70 |
accaactgtgagtaaaaagacactggtgcagagcaaact |
108 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3542372 |
accaactgtgagtcaaaagacactggtgcagagcaaact |
3542334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University