View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_212 (Length: 275)

Name: NF1345_low_212
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_212
NF1345_low_212
[»] chr5 (1 HSPs)
chr5 (1-180)||(3030825-3031013)


Alignment Details
Target: chr5 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 3030825 - 3031013
Alignment:
1 cccctacaaattattatggtagtaaatatgatgacatggagatatttgacactcagatagtttctttatggaacttctcaatttgacacgcttcactatt 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
3030825 cccctacaaattattatggtagtaactatgatgacatggagatatttgacactcagatagtttctttgtggaacttctcaatttgacacgcttcactatt 3030924  T
101 attggatgtggatgattttgtaaaacttttgttctagt---------tagataggtactcatttgttatagaaaattgctaaagagcac 180  Q
    ||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||    
3030925 attggatgtggatgattttgtaaaacttttgttctagttaggtttgctagataggtactcatttgttatagaaaattgctaaagagcac 3031013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University