View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_219 (Length: 266)

Name: NF1345_low_219
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_219
NF1345_low_219
[»] chr7 (2 HSPs)
chr7 (92-199)||(9972368-9972476)
chr7 (214-242)||(9972460-9972488)


Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 92 - 199
Target Start/End: Original strand, 9972368 - 9972476
Alignment:
92 gatttcatgtccaacatcttgacacatgtacacatcatagacatggattggttatgtactttttcctt-aaaaacattgttacgcactttaatgtcattt 190  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
9972368 gatttcatgtccaacatcttgacacatgtgcacatcatagacatggattggttatgtactttttccttaaaaaacattgttacgcactttaatgtcattt 9972467  T
191 taaatttac 199  Q
    |||||||||    
9972468 taaatttac 9972476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 242
Target Start/End: Original strand, 9972460 - 9972488
Alignment:
214 tgtcattttaaatttacaaaagctaaact 242  Q
    |||||||||||||||||||||||||||||    
9972460 tgtcattttaaatttacaaaagctaaact 9972488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University