View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_220 (Length: 266)
Name: NF1345_low_220
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_220 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 54773802 - 54773569
Alignment:
| Q |
18 |
gttattggagggaataaagcctgatccagtcacgtttgtgaatcttctctctgcctgtagtcatatgggactggtggatagaggctgggagtatttcaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54773802 |
gttattggagggaataaagcctgatccagtcacgtttgtgaatcttctctctgcctgtagtcatatgggactggtggatagaggctgggagtatttcaag |
54773703 |
T |
 |
| Q |
118 |
atgatgtttgatgagtttaacattgctccgatggtagagcattatgcttgcatggttgacatcttaagccgtgcaggcaagctcaatgaagctaaagagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54773702 |
atgatgtttgatgagtttaacattgctccgatggtagagcattatgcttgcatggttgacatcttaagccgtgcaggcaagctcaatgaagctaaagagt |
54773603 |
T |
 |
| Q |
218 |
tcattgaatctgcaacggttgatcacggtctgtg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54773602 |
tcattgaatctgcaacggttgatcacggtctgtg |
54773569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University