View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_221 (Length: 265)

Name: NF1345_low_221
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_221
NF1345_low_221
[»] chr7 (2 HSPs)
chr7 (72-179)||(9972368-9972476)
chr7 (30-58)||(9972460-9972488)


Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 72 - 179
Target Start/End: Complemental strand, 9972476 - 9972368
Alignment:
72 gtaaatttaaaatgacattaaagtgcgtaacaatgttttt-aaggaaaaagtacataaccaatccatgtctatgatgtgtacatgtgtcaagatgttgga 170  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
9972476 gtaaatttaaaatgacattaaagtgcgtaacaatgttttttaaggaaaaagtacataaccaatccatgtctatgatgtgcacatgtgtcaagatgttgga 9972377  T
171 catgaaatc 179  Q
    |||||||||    
9972376 catgaaatc 9972368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 58
Target Start/End: Complemental strand, 9972488 - 9972460
Alignment:
30 agtttagcttttgtaaatttaaaatgaca 58  Q
    |||||||||||||||||||||||||||||    
9972488 agtttagcttttgtaaatttaaaatgaca 9972460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University