View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_221 (Length: 265)
Name: NF1345_low_221
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_221 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 72 - 179
Target Start/End: Complemental strand, 9972476 - 9972368
Alignment:
| Q |
72 |
gtaaatttaaaatgacattaaagtgcgtaacaatgttttt-aaggaaaaagtacataaccaatccatgtctatgatgtgtacatgtgtcaagatgttgga |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9972476 |
gtaaatttaaaatgacattaaagtgcgtaacaatgttttttaaggaaaaagtacataaccaatccatgtctatgatgtgcacatgtgtcaagatgttgga |
9972377 |
T |
 |
| Q |
171 |
catgaaatc |
179 |
Q |
| |
|
||||||||| |
|
|
| T |
9972376 |
catgaaatc |
9972368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 58
Target Start/End: Complemental strand, 9972488 - 9972460
Alignment:
| Q |
30 |
agtttagcttttgtaaatttaaaatgaca |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9972488 |
agtttagcttttgtaaatttaaaatgaca |
9972460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University