View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_226 (Length: 260)

Name: NF1345_low_226
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_226
NF1345_low_226
[»] chr7 (2 HSPs)
chr7 (108-253)||(31755384-31755529)
chr7 (30-69)||(31755344-31755383)


Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 108 - 253
Target Start/End: Original strand, 31755384 - 31755529
Alignment:
108 aaacatatatattgaataataatgatagaattgaattcataaaatatagacctgttttttccaattcgtaagagatgtaatgatggaaagaaaaattgtt 207  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
31755384 aaacatgtatattgaataataatgatagaattgaattcataaaatatagacctgttttttccaattcgtaagagatgtaatgatggagagaaaaattgtt 31755483  T
208 tggacaatggagccagcaactattccaatccaaaggccctttgctt 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
31755484 tggacaatggagccagcaactattccaatccaaaggccctttgctt 31755529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 31755344 - 31755383
Alignment:
30 atgattgcctacaaaagttgcatttatcttgtattattaa 69  Q
    |||||||||||||||||||||||||| |||||||||||||    
31755344 atgattgcctacaaaagttgcatttaccttgtattattaa 31755383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University