View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_229 (Length: 259)
Name: NF1345_low_229
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_229 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 65 - 172
Target Start/End: Complemental strand, 9972476 - 9972368
Alignment:
| Q |
65 |
gtaaatttaaaatgacattaaagtgcgtaacaatgttttt-aaggaaaaagtacataaccaatccatgtctatgatgtgtacatgtgtcaagatgttgga |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9972476 |
gtaaatttaaaatgacattaaagtgcgtaacaatgttttttaaggaaaaagtacataaccaatccatgtctatgatgtgcacatgtgtcaagatgttgga |
9972377 |
T |
|
| Q |
164 |
catgaaatc |
172 |
Q |
| |
|
||||||||| |
|
|
| T |
9972376 |
catgaaatc |
9972368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 198 - 238
Target Start/End: Complemental strand, 9972336 - 9972296
Alignment:
| Q |
198 |
agcaagaggtataaacaaaatgtatcatatttgcatgtttt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9972336 |
agcaagaggtataaacaaaatgtatcatatttgcaagtttt |
9972296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 52
Target Start/End: Complemental strand, 9972488 - 9972460
Alignment:
| Q |
24 |
agtttagcttttgtaaatttaaaatgaca |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9972488 |
agtttagcttttgtaaatttaaaatgaca |
9972460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University