View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_23 (Length: 595)
Name: NF1345_low_23
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 3e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 3e-99
Query Start/End: Original strand, 30 - 221
Target Start/End: Complemental strand, 16401442 - 16401251
Alignment:
| Q |
30 |
gcataatgaatacagaacatctttgaggtgcactataagatgtgacaagtgactcaggaaggctattttgatcttcaacttcaactttggctttggtggt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16401442 |
gcataatgaatacagaacatctttgaggtgcacgataagatgtgacaagtgactcaggaaggctattttgatcttcaacttcaactttggctttggtggc |
16401343 |
T |
 |
| Q |
130 |
gcaatcctattttatgtatgggttttatgacttagtgttgcagttggttggtgttttgttcagtgttttgattttgtaatgaactttttgta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16401342 |
gcaatcctattttatgtatgggttttatgacttagtgttgcagttggttggtgttttgttcagtgttttgattttgtaatgaactttttgta |
16401251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 367 - 436
Target Start/End: Original strand, 15456316 - 15456384
Alignment:
| Q |
367 |
ttgaaggtagaaagtaggattgttcttgttgttgatagagaagatcctacaaatttttatataggatcct |
436 |
Q |
| |
|
||||||| || |||||| |||||||||| ||| |||||||| || |||||||| ||||||| |||||||| |
|
|
| T |
15456316 |
ttgaagggaggaagtagaattgttcttgctgtggatagagatgaccctacaaa-ttttatacaggatcct |
15456384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University