View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_230 (Length: 259)
Name: NF1345_low_230
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_230 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 29 - 246
Target Start/End: Complemental strand, 36743301 - 36743084
Alignment:
| Q |
29 |
actttggaagtgaaggaggtggagagtagaattctgaggatttgacgaacgcaaaagcttgagaaaaagtttgagacggaacgaatagagatggtggagt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36743301 |
actttggaagtgaaggaggtggagagtagaattctgaggatttgacgaacgcaaaagcttgagaaaaagtttgagacggaacgaatagagatggtggagt |
36743202 |
T |
 |
| Q |
129 |
tgattttgtttgtgaagattcaattacttcttgatatgaagggattcgtatcacagtggaacttttcttgtttattgaattgttttgctcttctgcttca |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36743201 |
tgattttgtttgtgaagattcaattacttcttgatatgaagggattcgtatcacagtggaacttttcttgtttattgaattgttttgcttttctgcttca |
36743102 |
T |
 |
| Q |
229 |
ttctccatttttctattc |
246 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36743101 |
ttctccatttttctattc |
36743084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University