View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_231 (Length: 258)
Name: NF1345_low_231
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_231 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 79 - 186
Target Start/End: Original strand, 9972368 - 9972476
Alignment:
| Q |
79 |
gatttcatgtccaacatcttgacacatgtacacatcatagacatggattggttatgtactttttcctt-aaaaacattgttacgcactttaatgtcattt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9972368 |
gatttcatgtccaacatcttgacacatgtgcacatcatagacatggattggttatgtactttttccttaaaaaacattgttacgcactttaatgtcattt |
9972467 |
T |
 |
| Q |
178 |
taaatttac |
186 |
Q |
| |
|
||||||||| |
|
|
| T |
9972468 |
taaatttac |
9972476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 13 - 53
Target Start/End: Original strand, 9972296 - 9972336
Alignment:
| Q |
13 |
aaaacatgcaaatatgatacattttgtttatacctcttgct |
53 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9972296 |
aaaacttgcaaatatgatacattttgtttatacctcttgct |
9972336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 201 - 229
Target Start/End: Original strand, 9972460 - 9972488
Alignment:
| Q |
201 |
tgtcattttaaatttacaaaagctaaact |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9972460 |
tgtcattttaaatttacaaaagctaaact |
9972488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University