View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_234 (Length: 256)

Name: NF1345_low_234
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_234
NF1345_low_234
[»] chr7 (2 HSPs)
chr7 (107-166)||(35122239-35122298)
chr7 (1-38)||(35122367-35122403)


Alignment Details
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 107 - 166
Target Start/End: Complemental strand, 35122298 - 35122239
Alignment:
107 gtgaatgagctatatagattggtggtttgctataattggtcatttggagtcatgtgatga 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35122298 gtgaatgagctatatagattggtggtttgctataattggtcatttggagtcatgtgatga 35122239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 35122403 - 35122367
Alignment:
1 ttaatgtatcttatctttataattcaaatataaaggtg 38  Q
    ||||||||||||||||| ||||||||||||||||||||    
35122403 ttaatgtatcttatctt-ataattcaaatataaaggtg 35122367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University