View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_234 (Length: 256)
Name: NF1345_low_234
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_234 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 107 - 166
Target Start/End: Complemental strand, 35122298 - 35122239
Alignment:
| Q |
107 |
gtgaatgagctatatagattggtggtttgctataattggtcatttggagtcatgtgatga |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35122298 |
gtgaatgagctatatagattggtggtttgctataattggtcatttggagtcatgtgatga |
35122239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 35122403 - 35122367
Alignment:
| Q |
1 |
ttaatgtatcttatctttataattcaaatataaaggtg |
38 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35122403 |
ttaatgtatcttatctt-ataattcaaatataaaggtg |
35122367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University