View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_240 (Length: 252)
Name: NF1345_low_240
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_240 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 75 - 182
Target Start/End: Original strand, 9972368 - 9972476
Alignment:
| Q |
75 |
gattttatgtccaacatcttgacacatgtacacatcatagacatggattggttatgtactttttcctt-aaaaacattgttacgcactttaatgtcattt |
173 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9972368 |
gatttcatgtccaacatcttgacacatgtgcacatcatagacatggattggttatgtactttttccttaaaaaacattgttacgcactttaatgtcattt |
9972467 |
T |
|
| Q |
174 |
taaatttac |
182 |
Q |
| |
|
||||||||| |
|
|
| T |
9972468 |
taaatttac |
9972476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 225
Target Start/End: Original strand, 9972460 - 9972488
Alignment:
| Q |
197 |
tgtcattttaaatttacaaaagctaaact |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9972460 |
tgtcattttaaatttacaaaagctaaact |
9972488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University