View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_270 (Length: 241)

Name: NF1345_low_270
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_270
NF1345_low_270
[»] chr4 (1 HSPs)
chr4 (1-66)||(45650364-45650429)


Alignment Details
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 45650364 - 45650429
Alignment:
1 atgaaagtgtcaggttgaacagaagactactaatattactagaaaacaagttgttattattggagt 66  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
45650364 atgaaagtgtcaggttgaacagaagactactactattactagaaaacaagttgttattattggagt 45650429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University