View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_274 (Length: 235)
Name: NF1345_low_274
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_274 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 61 - 168
Target Start/End: Original strand, 9972368 - 9972476
Alignment:
| Q |
61 |
gatttcatgtccaacatcttgacacatgtacacatcatagacatggattggttatgtactttttcctt-aaaaacattgttacgcactttaatgtcattt |
159 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9972368 |
gatttcatgtccaacatcttgacacatgtgcacatcatagacatggattggttatgtactttttccttaaaaaacattgttacgcactttaatgtcattt |
9972467 |
T |
 |
| Q |
160 |
taaatttac |
168 |
Q |
| |
|
||||||||| |
|
|
| T |
9972468 |
taaatttac |
9972476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 211
Target Start/End: Original strand, 9972460 - 9972488
Alignment:
| Q |
183 |
tgtcattttaaatttacaaaagctaaact |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9972460 |
tgtcattttaaatttacaaaagctaaact |
9972488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University