View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_276 (Length: 230)
Name: NF1345_low_276
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_276 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 20 - 152
Target Start/End: Complemental strand, 29838672 - 29838540
Alignment:
| Q |
20 |
aaagaatatattaactacttttcagtttaatttgcctattgcgacaaattagcaattactagtcattaaatgtacatgcacgcatgcacgatcacagaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838672 |
aaagaatatattaactacttttcagtttaatttgcctattgcgacaaattagcaattactagtcattaaatgtacatgcacgcatgcacgatcacagaag |
29838573 |
T |
|
| Q |
120 |
cacacagaagaaacaagatcatttgatgatgtc |
152 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
29838572 |
cacacagaagaaacaagatcatttgataatgtc |
29838540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University