View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1345_low_277 (Length: 230)
Name: NF1345_low_277
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1345_low_277 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 8716501 - 8716288
Alignment:
| Q |
1 |
ttgtcttcgtccagcagccacttgaccacatctgtcaccctttcctacaactgaacctctgtcaacgcctagtataactccgattcactcctcttcctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8716501 |
ttgtcttcgtccagcagccacttgaccacatctgtcaccctttcctacaactgaacctctgtcaacgcctagtataactcggattcactcctcttcctca |
8716402 |
T |
 |
| Q |
101 |
ctggaccgaatgctgcaccagaaccagctccggttctgctgtgtaccagctggagtaaatttctgcgtgagtgatgctctttgtatgagactagactgta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
8716401 |
ctggaccgaatgctgcaccagaaccagctccggttctgctgtgtaccagctggagtaaatttctgcgcgagtgatgctctttgtatgagactagactata |
8716302 |
T |
 |
| Q |
201 |
agggattgaatatt |
214 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
8716301 |
aaggattgaatatt |
8716288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 8735740 - 8735527
Alignment:
| Q |
1 |
ttgtcttcgtccagcagccacttgaccacatctgtcaccctttcctacaactgaacctctgtcaacgcctagtataactccgattcactcctcttcctca |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||| ||| | |||||||||| |||||||| ||||||||||||| |||||| |||||||||| | |
|
|
| T |
8735740 |
ttgtcttcgtccggcagccacttgaccacatctttcaccccttcttgcaactgaaccgctgtcaacacctagtataactcagattcattcctcttcctta |
8735641 |
T |
 |
| Q |
101 |
ctggaccgaatgctgcaccagaaccagctccggttctgctgtgtaccagctggagtaaatttctgcgtgagtgatgctctttgtatgagactagactgta |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||| ||||||||||||||||||||||||||| |
|
|
| T |
8735640 |
ttggaccgaattctgcaccagaaccagctccggttctgctgtgtaccagcttgagtaaatttctgagcgagcaatgctctttgtatgagactagactgta |
8735541 |
T |
 |
| Q |
201 |
agggattgaatatt |
214 |
Q |
| |
|
| |||||| ||||| |
|
|
| T |
8735540 |
aaggattggatatt |
8735527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University