View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1345_low_279 (Length: 229)

Name: NF1345_low_279
Description: NF1345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1345_low_279
NF1345_low_279
[»] chr6 (1 HSPs)
chr6 (18-141)||(29838680-29838803)


Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 18 - 141
Target Start/End: Original strand, 29838680 - 29838803
Alignment:
18 gttccattttgccacaatccgataatgtgaaatttaatcttttggtatcgactgatagaaagcagacgaacttctattgatatcttcttaaaggcttctg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
29838680 gttccattttgccacaatccgataatgtgaaatttaatcttttggtatcgactaatagaaagcagacgaacttctattgatatcttcttaaaggcttctg 29838779  T
118 gatatctggattgcgcagtcaaac 141  Q
    ||||||||||||||||||||||||    
29838780 gatatctggattgcgcagtcaaac 29838803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University